Response to Comment on “Tumor-initiating cells establish an IL-33-TGF-{beta} niche signaling loop to promote cancer progression”

Response to Comment on “Tumor-initiating cells establish an IL-33-TGF-{beta} niche signaling loop to promote cancer progression”
Spread the love

Abstract

Kamphuis et al. argue that macrophages accumulated in the proximity of tumor-initiating cells do not express the high-affinity immunoglobulin E receptor FcεRIα. Although we cannot exclude the possibility of nonspecific binding of anti-FcεRIα antibody (clone MAR-1), we provide evidence that macrophages in squamous cell carcinomas express FcεRIα and that IL-33 induces FcεRIα expression in bone marrow cell–derived macrophages.

FcεRIα is an established marker of mast cells and basophils. However, our recent work found that a subset of tumor-associated macrophages (TAMs) accumulating around tumor-initiating cells express FcεRIα (1), which may have functional importance in those specific macrophages. We thank Kamphuis et al. for confirming that FcεRIα+ cells are indeed TAMs (using the CIBERSORT method) and for their comments on the anti-FcεRIα antibody (clone MAR-1) (2).

Kamphuis et al. claim the nonspecific binding of MAR-1 on the basis of high mean fluorescence intensity (MFI) detected in the spleen macrophages (2). However, our data indicated that splenic macrophages from both tumor-free and tumor-bearing mice did not show such high MFI (Fig. 1A). By contrast, macrophages in squamous cell carcinomas (SCCs) showed high FcεRIα expression dependent on tumor epithelial cell–derived interleukin-33 (IL-33; Fig. 1A). The discrepancy observed in the splenic macrophages could be due to staining conditions and signal acquisition in flow cytometry analysis and different reagents, including mouse lines. Although we do not have detailed information on their mutant mice and the target allele’s gene product, the human FCER1A gene insertion in the mouse Fcer1a locus might result in unexpected gene products.

Fig. 1 Data that support FcεRIα expression in TAMs in vivo and in IL-33–induced macrophages in vitro.

(A) Left: Flow cytometry analysis of macrophages (MΦ) in the spleen of non–tumor-bearing and tumor-bearing TetO-Hras; Rosa26-YFP (FVB background) mice and tumor-associated macrophages in control and Il33 knockdown (KD) tumors. Right: Mean fluorescence intensity (MFI) of MAR-1 staining in different macrophage populations. FMO, fluorescence-minus-one. (B) Immunolabeling of mouse skin showing FcεRIα expression in tryptase+ dermal mast cells (arrowheads). FcεRIα was detected by anti-FcεRIα rabbit polyclonal antibodies (Proteintech, #10980-1-AP). The right panel shows FcεRIα expression in the same image. Asterisk indicates staining artifact on cell-free regions. (C) Immunolabeling of mouse SCC showing FcεRIα expression detected by the same antibody used in (B) in F4/80+ macrophages at the peri-tumor area (arrowheads). (D) Immunolabeling of mouse SCC showing the colocalization of FcεRIα (green; Proteintech, #10980-1-AP) and IgE (red) (arrowheads). IgE was detected by rat anti-mouse IgE (clone R35-92), which suggests cell surface expression of functional FcεRIα. (E) qPCR analysis of Fcer1a and Fcγ receptor genes in IL-33–induced macrophages transduced with scramble control or Fcer1a shRNA in vitro. (F) Histogram presentation of FcεRIα staining (MAR-1) in control and Fcer1a KD bone marrow–derived macrophages induced by IL-33 in vitro. (G) Immunolabeling of bone marrow cell–derived F4/80+ macrophages after IL-33 treatment for 6 days. H2B-mScarlet+ cells (arrowheads) indicate macrophages transduced with Fcer1a shRNA. *P P P Fcer1a shRNA sequences: shRNA#1, 5′-CCCACCATGGATTAGAATATT-3′; shRNA#2, 5′-CCGAACTCCTAACCTAGATAC-3′. qPCR primers (forward, reverse): Fcer1a_1, GAGTGCCACCGTTCAAGACA, GTAGATCACCTTGCGGACATTC; Fcer1a_2, TGTCCGCAAGGTGATCTACTA, TGGCCTCTCTAATGGAGACGG; Fcgr1, GTCGGTGGGGAAGTGGTTAAT, CCCCTCACACCATAAAGTGAC; Fcgr2b, AGGGCCTCCATCTGGACTG, GTGGTTCTGGTAATCATGCTCTG; Fcgr3, CAGAATGCACACTCTGGAAGC, GGGTCCCTTCGCACATCAG; Fcgr4, GGTGAACCTAGACCCCAAGTG, AGGCTTTCGTTATGGAACCAC.

” data-hide-link-title=”0″ data-icon-position=”” href=”https://science.sciencemag.org/content/sci/372/6538/eabf3316/F1.large.jpg?width=800&height=600&carousel=1″ rel=”gallery-fragment-images-80468654″ title=”Data that support FcεRIα expression in TAMs in vivo and in IL-33–induced macrophages in vitro. (A) Left: Flow cytometry analysis of macrophages (MΦ) in the spleen of non–tumor-bearing and tumor-bearing TetO-Hras; Rosa26-YFP (FVB background) mice and tumor-associated macrophages in control and Il33 knockdown (KD) tumors. Right: Mean fluorescence intensity (MFI) of MAR-1 staining in different macrophage populations. FMO, fluorescence-minus-one. (B) Immunolabeling of mouse skin showing FcεRIα expression in tryptase+ dermal mast cells (arrowheads). FcεRIα was detected by anti-FcεRIα rabbit polyclonal antibodies (Proteintech, #10980-1-AP). The right panel shows FcεRIα expression in the same image. Asterisk indicates staining artifact on cell-free regions. (C) Immunolabeling of mouse SCC showing FcεRIα expression detected by the same antibody used in (B) in F4/80+ macrophages at the peri-tumor area (arrowheads). (D) Immunolabeling of mouse SCC showing the colocalization of FcεRIα (green; Proteintech, #10980-1-AP) and IgE (red) (arrowheads). IgE was detected by rat anti-mouse IgE (clone R35-92), which suggests cell surface expression of functional FcεRIα. (E) qPCR analysis of Fcer1a and Fcγ receptor genes in IL-33–induced macrophages transduced with scramble control or Fcer1a shRNA in vitro. (F) Histogram presentation of FcεRIα staining (MAR-1) in control and Fcer1a KD bone marrow–derived macrophages induced by IL-33 in vitro. (G) Immunolabeling of bone marrow cell–derived F4/80+ macrophages after IL-33 treatment for 6 days. H2B-mScarlet+ cells (arrowheads) indicate macrophages transduced with Fcer1a shRNA. *P

<figcaption id="F1-caption">
<span>Fig. 1</span> <span>Data that support Fc&epsilon;RI&alpha; expression in TAMs in vivo and in IL-33&ndash;induced macrophages in vitro.</span><p id="p-4">(<strong>A</strong>) Left: Flow cytometry analysis of macrophages (M&Phi;) in the spleen of non&ndash;tumor-bearing and tumor-bearing <em>TetO-Hras; Rosa26-YFP</em> (FVB background) mice and tumor-associated macrophages in control and <em>Il33</em> knockdown (KD) tumors. Right: Mean fluorescence intensity (MFI) of MAR-1 staining in different macrophage populations. FMO, fluorescence-minus-one. (<strong>B</strong>) Immunolabeling of mouse skin showing Fc&epsilon;RI&alpha; expression in tryptase<sup>+</sup> dermal mast cells (arrowheads). Fc&epsilon;RI&alpha; was detected by anti-Fc&epsilon;RI&alpha; rabbit polyclonal antibodies (Proteintech, #10980-1-AP). The right panel shows Fc&epsilon;RI&alpha; expression in the same image. Asterisk indicates staining artifact on cell-free regions. (<strong>C</strong>) Immunolabeling of mouse SCC showing Fc&epsilon;RI&alpha; expression detected by the same antibody used in (B) in F4/80<sup>+</sup> macrophages at the peri-tumor area (arrowheads). (<strong>D</strong>) Immunolabeling of mouse SCC showing the colocalization of Fc&epsilon;RI&alpha; (green; Proteintech, #10980-1-AP) and IgE (red) (arrowheads). IgE was detected by rat anti-mouse IgE (clone R35-92), which suggests cell surface expression of functional Fc&epsilon;RI&alpha;. (<strong>E</strong>) qPCR analysis of <em>Fcer1a</em> and Fc&gamma; receptor genes in IL-33&ndash;induced macrophages transduced with scramble control or <em>Fcer1a</em> shRNA in vitro. (<strong>F</strong>) Histogram presentation of Fc&epsilon;RI&alpha; staining (MAR-1) in control and <em>Fcer1a</em> KD bone marrow&ndash;derived macrophages induced by IL-33 in vitro. (<strong>G</strong>) Immunolabeling of bone marrow cell&ndash;derived F4/80<sup>+</sup> macrophages after IL-33 treatment for 6 days. H2B-mScarlet<sup>+</sup> cells (arrowheads) indicate macrophages transduced with <em>Fcer1a</em> shRNA. *<em>P</em> P P Fcer1a shRNA sequences: shRNA#1, 5&prime;-CCCACCATGGATTAGAATATT-3&prime;; shRNA#2, 5&prime;-CCGAACTCCTAACCTAGATAC-3&prime;. qPCR primers (forward, reverse): <em>Fcer1a_1</em>, GAGTGCCACCGTTCAAGACA, GTAGATCACCTTGCGGACATTC; <em>Fcer1a_2</em>, TGTCCGCAAGGTGATCTACTA, TGGCCTCTCTAATGGAGACGG; <em>Fcgr1</em>, GTCGGTGGGGAAGTGGTTAAT, CCCCTCACACCATAAAGTGAC; <em>Fcgr2b</em>, AGGGCCTCCATCTGGACTG, GTGGTTCTGGTAATCATGCTCTG; <em>Fcgr3</em>, CAGAATGCACACTCTGGAAGC, GGGTCCCTTCGCACATCAG; <em>Fcgr4</em>, GGTGAACCTAGACCCCAAGTG, AGGCTTTCGTTATGGAACCAC.</p>  </figcaption>

To ascertain the FcεRIα expression in TAMs that is not limited to detection by MAR-1, we used another antibody that recognizes mouse FcεRIα (Proteintech, 10980-1-AP). This alternative antibody detected FcεRIα expressed in tryptase+ mast cells in the dermis (Fig. 1B). The same antibody identified the FcεRIα+ TAMs in SCC tumors (Fig. 1C). We also confirmed that these FcεRIα+ cells were labeled with anti–immunoglobulin E (IgE) antibody (BD Biosciences, clone R35-92), suggesting functional FcεRIα expression in TAMs (Fig. 1D). Moreover, using multiple FcεRIα antibodies (R&D, 773704; R&D, AF6678; BioLegend, clone CRA1), our article showed FcεRIα+ CD206+ TAMs accumulating around transforming growth factor–β (TGF-β)–responding tumor cells in human SCC (1). These data strengthen our finding of FcεRIα+ TAMs in SCC tumors, which may help us to understand how TAMs function in tumors of skin origin.

We next addressed FcεRIα expression in bone marrow cell–derived macrophages in vitro. Our published quantitative polymerase chain reaction (qPCR) analysis showed that Fcer1a mRNA was higher in IL-33–induced macrophages than in CSF1-induced ones, as tested by multiple primer sets for Fcer1a (1). Two short hairpin RNAs (shRNAs) against the Fcer1a gene down-regulated Fcer1a mRNA in IL-33–induced macrophages, confirming the presence of Fcer1a transcripts (Fig. 1E). We validated that Fcer1a shRNA sequences do not match with any Fcγ receptor genes and confirmed that Fcer1a knockdown (KD) did not affect the expression of Fcγ receptor genes, except for a mild increase of Fcgr1 (Fig. 1E).

We used this shRNA-based KD assay in bone marrow cell–derived macrophages to address the issue of MAR-1 specificity in probing FcεRIα expression. We reasoned that this model system could establish the specificity of MAR-1 in detecting FcεRIα expression if the staining is lost in Fcer1a KD samples. To this end, we analyzed Fcer1a KD at the protein level using MAR-1 in IL-33–induced macrophages. Using flow cytometry analysis, we confirmed that lentivirally delivered scramble control had no significant effect on FcεRIα expression (Fig. 1F). In contrast, MAR-1–dependent staining was suppressed in Fcer1a KD cells derived using two independent shRNAs (Fig. 1F). Moreover, immunofluorescence analysis of cultured macrophages showed that Fcer1a KD cells (detected by H2B-mScarlet) had lower FcεRIα protein expression than the surrounding internal controls (Fig. 1G). These data support the idea that MAR-1 can detect FcεRIα expressed in IL-33–induced macrophages.

<

p id=”p-8″>Our published and additional data with various control conditions presented here strengthen our hypothesis that FcεRIα is expressed in TAMs in an IL-33–dependent manner. Although our data cannot exclude the possibility of nonspecific binding of MAR-1, Wang et al. used the MAR-1 antibody to show FcεRIα expression on mast cells and macrophages in an abdominal aortic aneurysm mouse model (3). Moreover, they showed that FcεRIα expression in macrophages was not detected in Fcer1a-deficient mice (3), which suggests that MAR-1 could recognize FcεRIα expression in macrophages. It has been increasingly recognized that FcεRIα is expressed in many cell types other than mast cells and basophils in humans, rats, and mice under various inflammatory conditions (47). Because FcεRIα surface expression is tightly regulated by the presence of IgE (8, 9), it may be important to understand the mechanism of FcεRI expression in various cell types in tissues that show deposition of IgE.

Acknowledgments: Supported by the Collins Medical Trust and the start-up fund from the Knight Cancer Institute, Oregon Health & Science University (N.O.).